| Catalog | name | Description | price |
|---|---|---|---|
| R-M2-10123 | C18-CpG-CY5 | C18-CpG-CY5/C18-Thio DNA (CpG1018)-CY5 is a fluorescently labeled immunostimulant primarily used in vaccine adjuvant research and immune activation experiments. This product is only for scientific research and cannot be used on the human body. | price> |
| R-M2-10125 | CY5-CpG(TCGAACGTTCGAACGTTCGAACGTTCGAAT) | CY5-CpG(TCGAACGTTCGAACGTTCGAACGTTCGAAT) is a type B CpG oligonucleotide with fluorescent labeling. Its core function is to activate the immune response through the TLR9 pathway, and it is commonly used in vaccine adjuvants and immunotherapy research. Application Scenario: Vaccine adjuvant: enhances antigen immunogenicity and reduces dosage. Immunotherapy: Used in combination with chemotherapy and radiotherapy to improve the tumor microenvironment. Mechanism research: Analyze the TLR9 signaling pathway and immune cell activation mechanism. | price> |
| R-M1-8500 | Cy5.5-Enterodiol | Cy5.5-Enterodiol conjugate can be utilized as a molecular probe for studying the uptake, metabolism, and distribution of Enterodiol in biological systems. The fluorescent properties of Cy5.5 allow for visualizing and tracking the localization of Enterodiol within cells or tissues, providing valuable insights into its biological activities and potential therapeutic applications. | price> |
| R-M1-8501 | Cy5-Tacrolimus | Cy5-Tacrolimus conjugate can serve as a tool for studying the distribution, localization, and uptake of Tacrolimus within cells or tissues. It allows for the visualization and tracking of the drug presence and accumulation, providing valuable insights into its pharmacokinetics and biodistribution in biological systems. | price> |
| R-M1-8504 | Cy2-Agarose | Cy2-Agarose refers to a conjugate of the fluorescent dye Cy2 and agarose, a polysaccharide derived from seaweed commonly used in molecular biology applications as a gel matrix. | price> |
| R-M1-8505 | Cy2-sucrose | Cy2-sucrose is a fluorescent dye-conjugated derivative of sucrose. Cy2-sucrose is a useful tool for visualizing and studying the behavior and distribution of sucrose in biological samples. | price> |
| R-M1-8511 | Cy2-Raffinose | Cy2-Raffinose is a fluorescent dye-conjugated derivative of raffinose. Cy2, also known as cyanine 2, is a green-fluorescent dye that can be used as a labeling tool in various biological applications. By conjugating Cy2 to the raffinose molecule,it can fluorescently tag raffinose and track its movement and localization in cells or tissues using fluorescence microscopy techniques. This allows for the study of raffinose transport, metabolism, and dynamics in biological systems. | price> |
| R-M1-8517 | Cy5-Lentinan | Cy5-Lentinan is a fluorescent dye-labeled form of lentinan.By labeling lentinan with the fluorescent dye Cy5, researchers can track its distribution and localization in cells and tissues using fluorescence microscopy or other imaging techniques. This allows for the visualization and quantification of lentinan uptake and distribution within biological systems. | price> |
| R-M1-8519 | Cy3-Tz | Cy3-Tz,Cy3-tetrazine is a compound that combines the fluorescent properties of Cy3 with the reactive properties of tetrazine, allowing for specific and efficient labeling of biomolecules via the IEDDA click chemistry reaction with TCO-functionalized molecules. | price> |
| R-M1-8544 | Cy5-gluconic acid | Cy5-gluconic acid can be applied in fluorescent imaging, bioconjugation, or other research areas. | price> |

Items-$0.00

Email:
Tel.:
RuixiBiotechCo.Ltd /KamulinBiotechco.ltd
Add: Room 20F 2002, Meiyuan Building, Yanta District, Xi’ an City, Shaanxi Province 710061 China
Tel: 02988811435
Fax: (86-29)8881-1435
Email: sales@ruixibiotech.com
Web: http://www.ruixibiotech.com


