Catalog name Description price
R-M2-10113 CY5-Lenvatinib CY5-Lenvatinib is a fluorescent dye labeled compound. It is mainly used for scientific research experiments, such as drug distribution research or biological imaging. It retains the original anti-tumor activity of lenvatinib, and through the fluorescence properties of CY5, it can more intuitively track the distribution and metabolism of the drug in the body. price>
R-M2-10115 CY5-Azathioprine CY5-Azathioprine is a CY5 fluorescently labeled derivative of Azathioprine, mainly used for visual tracking and mechanism research of immunosuppressants. It combines the immunosuppressive activity of azathioprine and the imaging ability of CY5 fluorophore, making it suitable for studying drug distribution, metabolic dynamics, and target localization in cells or tissues. price>
R-M2-10116 CY5-S-sulfo-L-cysteine CY5-S-sulfo-L-cysteine is a compound that combines CY5 fluorescent dye and S-sulfo-L-cysteine, mainly used for biological labeling, immunofluorescence imaging, and flow cytometry. price>
R-M1-8483 CY5-Gadobutrol CY5-Gadobutrol combines the contrast-enhancing properties of gadobutrol with the fluorescent capabilities of CY5, allowing for the visualization and tracking of the contrast agent in biological samples through fluorescence imaging. price>
R-M2-10118 CY3-Clindamycin CY3-Clindamycin is a CY3 fluorescently labeled derivative of Clindamycin, mainly used for fluorescence tracing and biodistribution studies of antibacterial drugs. It combines the antibacterial activity of clindamycin and the fluorescence properties of CY3, making it suitable for in vivo imaging, cell localization, and pharmacokinetic analysis. price>
R-M1-8484 CY2-Cisplatin CY2-Cisplatin represents the fusion of a fluorescent dye (CY2) with the chemotherapeutic agent cisplatin, enabling the visualization and tracking of cisplatin in biological systems using fluorescence-based methods. Cisplatin is a widely used anticancer drug that works by damaging the DNA of cancer cells, leading to their death. It is particularly effective against testicular, ovarian, bladder, and lung cancers. price>
R-M1-8486 Cy3-dopamine Cy3-Dopamine combines the fluorescent properties of Cy3 with the neurotransmitter dopamine, allowing for the visualization and tracking of dopamine in biological samples using fluorescence-based techniques. price>
R-M2-10121 Cy5-Thio DNA(CpG1018) Cy5-Thio DNA (CpG1018) is a fluorescently labeled immunostimulant primarily used in vaccine adjuvant research and immune activation experiments. This product is only for scientific research and cannot be used on the human body. price>
R-M2-10123 C18-CpG-CY5 C18-CpG-CY5/C18-Thio DNA (CpG1018)-CY5 is a fluorescently labeled immunostimulant primarily used in vaccine adjuvant research and immune activation experiments. This product is only for scientific research and cannot be used on the human body. price>
R-M2-10125 CY5-CpG(TCGAACGTTCGAACGTTCGAACGTTCGAAT) CY5-CpG(TCGAACGTTCGAACGTTCGAACGTTCGAAT) is a type B CpG oligonucleotide with fluorescent labeling. Its core function is to activate the immune response through the TLR9 pathway, and it is commonly used in vaccine adjuvants and immunotherapy research. Application Scenario: Vaccine adjuvant: enhances antigen immunogenicity and reduces dosage. Immunotherapy: Used in combination with chemotherapy and radiotherapy to improve the tumor microenvironment. Mechanism research: Analyze the TLR9 signaling pathway and immune cell activation mechanism. price>