CY5-CpG(TCGAACGTTCGAACGTTCGAACGTTCGAAT)

Catalog #	Pkg Size	Price(USD)	Quantity	Buy this product
R-M2-10125	100ug	inquiry

Product description

CY5-CpG(TCGAACGTTCGAACGTTCGAACGTTCGAAT) is a type B CpG oligonucleotide with fluorescent labeling. Its core function is to activate the immune response through the TLR9 pathway, and it is commonly used in vaccine adjuvants and immunotherapy research.
Application Scenario:
Vaccine adjuvant: enhances antigen immunogenicity and reduces dosage.
Immunotherapy: Used in combination with chemotherapy and radiotherapy to improve the tumor microenvironment.
Mechanism research: Analyze the TLR9 signaling pathway and immune cell activation mechanism.

Appearance	N/A
Molecular weight	N/A
Solubility	N/A
CpG sequence (phosphorothioate backbone)	TCGAACGTTCGAACGTTCGAACGTTCGAAT
Storage	-20℃, protected from light and moisture
Transportation	4-25℃ temperature for up to 2 weeks
Stability	1 year

Document