Xi'an ruixi Biological Technology Co

Home > Keywords >

Catalog	name	Description	price
R-M2-10126	DMG-GPQGIAGQR-PEG-CpG-ODN	DMG-GPQGIAGQR-PEG-CpG-ODN is a CpG oligonucleotide modified with PEG and DMG, mainly used in vaccine adjuvant and immunotherapy research. Application: Vaccine adjuvant: can enhance the immunogenicity of vaccines and reduce antigen dosage. Immunotherapy: Used in combination with chemotherapy and radiotherapy to improve the tumor microenvironment. Mechanism research: Used to analyze the TLR9 signaling pathway and immune cell activation mechanism.	price>
R-M1-8492	Tetracycline-OVA	Tetracycline-OVA/OVA Conjugated Tetracycline (TTC)/Tetracycline [OVA] /Tetracycline (TTC) Protein (OVA)/Tetracycline protein (OVA) refers to the conjugation of Tetracycline with Ovalbumin (OVA). Tetracycline is a widely used antibiotic medication that belongs to the class of tetracycline antibiotics. Ovalbumin, on the other hand, is a protein found in egg whites and is commonly used as an antigen in immunological research.	price>
R-C-6110	PI(5)P diC8 CAS:291527-92-9	Dioctanoyl Phosphatidylinositol 5-phosphate,PtdIns(5)P C8,PI(5)P C8, or PI5P,Dioctanoyl Phosphatidylinositol 5-phosphate,PtdIns(5)P C8,PI(5)P C8,or PI5P,Phosphoinositides (PIPns) are minor components of cellular membranes but are integral signaling molecules for cellular communication.Phosphatidylinositol 5-phosphate (PI(5)P) is a rare lipid found in the nucleus that can bind the PHD finger of the nuclear adapter protein ING2.PI(5)P is phosphorylated to PI(4,5)P2 by Type II PIP kinases.	price>
R-M2-10127	Chol-GPQGIAGQR-PEG-CpG-ODN	Chol-GPQIAGQR-PEG-CpG-ODN/Cholesterol-GPQGIAGQR-PEG-CpG-ODN is a CpG oligonucleotide modified with cholesterol (Chol), GPQGIAGQR peptide, and PEG2000, mainly used in vaccine adjuvant and immunotherapy research. Application: Vaccine adjuvant: can enhance the immunogenicity of vaccines and reduce antigen dosage. Immunotherapy: Used in combination with chemotherapy and radiotherapy to improve the tumor microenvironment. Mechanism research: Used to analyze the TLR9 signaling pathway and immune cell activation mechanism.	price>
R-M2-10128	CpG@GNPs	CpG oligonucleotide(CpG-ODN) modified gold nanoparticles (GNPs) are a promising material for immunotherapy and vaccine adjuvants. Application scenarios: Vaccine adjuvant: can enhance the immunogenicity of vaccines and reduce antigen dosage. Immunotherapy: It is used to treat cancer and infectious diseases, inhibit tumors or eliminate pathogens by activating the immune system. Biosensing: Utilizing the optical properties of gold nanoparticles to construct a highly sensitive and selective nano biosensing platform. Notes: Dispersion method of solid dry powder: Take an appropriate amount of solid dry powder as needed, add pure water until the freeze-dried powder is completely dissolved, and use water bath ultrasound for 5-30 seconds to promote the dispersion of nanomaterials. If the dispersion is not complete, the water bath ultrasound time can be extended to 2 minutes. If physiological saline or buffer solution is needed for dispersion, please add an equal volume of 2 x physiological saline or buffer solution to make the final concentration of physiological saline or buffer solution 1 x normal concentration.	price>
R-M1-8493	FITC-DITWDQLWDLMK	E-selectin binding peptide (Esbp, primary sequence DITWDQLWDLMK),FITC labelled /FITC-DITWDQLWDLMKcan be used for selectively target drug delivery systems to tumor vasculature research. Among,E-selectin binding peptide (Esbp, primary sequence DITWDQLWDLMK) as targeting ligand.The conjugation of FITC with the peptide sequence DITWDQLWDLMK allows for the visualization and tracking of the peptide using fluorescence microscopy or other fluorescence-based techniques. This compound can be used in various research applications, such as cellular imaging, protein localization studies, or receptor-ligand interaction studies.	price>
R-C-6111	PLPC (16:0/18:2 PC) CAS:17708-90-6	1-Palmitoyl-2-linoleoyl-sn-glycero-3-phosphocholine(PLPC) is a phosphocholine with palmitic(16:0)and linoleic(18:2) acids acyl chains.Phosphatidylcholine(PC)is generally the most abundant lipid in animal cell membranes providing structural framework.	price>
R-M1-8494	TTQ-F-PSar water-soluble	TTQ-F-PSar water-soluble/TTQ-F(tetraaminoquinoline-fluorophore)-PSar(proline-substituted sarcosine) water-soluble is a compound that consists of two main components: TTQ-F and PSar. TTQ-F: TTQ-F refers to tetraaminoquinoline-fluorophore, which is a fluorescent molecule containing a quinoline core. It is often used as a fluorescent probe in various biological and chemical applications. PSar: PSar stands for proline-substituted sarcosine, which is a modified amino acid. Sarcosine is a derivative of the natural amino acid glycine. TTQ-F-PSar could serve as a fluorescence probe for targeting specific molecules or for studying cellular processes.	price>
R-C-6112	PLPEth (16:0/18:2 PEth) CAS：336786-73-3	1-Palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanol(PLPEth)is a form of phosphatidylethanol(PEth), which is formed primarily by transphosphatidylation of phosphatidylcholine(PC)by phospholipase D. Most PEth(about 75%)is incorporated into erythrocyte membranes,and is one of the longest-lived circulating EtOH metabolite yet identified.	price>
R-M2-10129	RhB labeled mPEG-b-PCGE loaded resveratrol	RhB labeled mPEG-b-PCGE loaded resveratrol is a nanocarrier that combines fluorescence tracing and drug delivery functions, mainly used for the delivery and distribution research of resveratrol. Rhodamine B serves as a fluorescent probe for real-time tracking of carrier distribution and drug release in vivo.	price>
R-M1-8495	Fitc-β-Ergosterol	The conjugation of FITC with β-Ergosterol allows for the visualization and tracking of β-Ergosterol in biological systems using fluorescence microscopy or other fluorescence-based techniques. This compound may be used to investigate the distribution, localization, and metabolism of β-Ergosterol in cells or tissues.	price>
R-C-6113	POPEth CAS：765260-45-5	1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanol(POPEth)is a form of phosphatidylethanol(PEth), which is formed primarily by transphosphatidylation of phosphatidylcholine(PC)by phospholipase D. Most PEth(about 75%)is incorporated into erythrocyte membranes,and is one of the longest-lived circulating EtOH metabolite yet identified.	price>
R-M2-10130	E7(EPLQLKM)-peg-Chol	E7 (EPLQLKM)-peg-Chol/E7(EPLQLKM)-peg-Cholesterol/Cholesterol-peg-E7(EPLQLKM) is an E7 derived peptide modified with PEG and cholesterol (Chol), mainly used for targeted drug delivery and biological coupling research. Application: Targeted therapy: Can be coupled with chemotherapy drugs or siRNA for targeted therapy of HPV related tumors. Immune regulation: used in vaccine adjuvant or immunotherapy research by activating the TLR pathway or regulating immune cell function. Biocoupling: As a connecting arm, it is used to construct peptide drug conjugates (PDCs) or nanocarriers.	price>
R-M1-8496	mpeg2000-SFSHHTPILPLCK	MPEG2000-SFSHHTPILPLCK is a peptide sequence composed of specific amino acids.	price>
R-C-6114	PtdIns(4,5)P2 a-fluorovinylphosphate diC8	PtdIns(4,5)P2 a-fluorovinylphosphate diC8 is a water soluble, synthetic PI(4,5)P2 analog in which the phosphodiester bond has been rendered metabolically stable via the α-fluorovinylphosphonate.	price>
R-M2-10131	/5/TCGTCGTTTTGTCGTTTTGTCGTT*/3/Cholesteryl/	/5 /* T * C * G * T * G * T * T * T * G * T * G * T * T * T * G * T * T * G * T * T * 3/Cholesteryl/;TCGTCGTTTTGTCGTTTGTCGTT-Cholesteryl is also a cholesterol modified oligonucleotide, mainly used for drug delivery and biological coupling research.	price>
R-M1-8497	RGD-alginate	RGD-alginate/RGD-peptide modified alginate/arginine-glycine-aspartate (RGD)-peptide-coupled alginates is a biomaterial consisting of alginate, a polysaccharide derived from seaweed, that has been modified with the RGD peptide sequence. RGD-alginate is commonly used in biomedical applications, particularly in tissue engineering and regenerative medicine.The RGD peptide sequence (Arg-Gly-Asp) is known for its ability to specifically bind to integrin receptors on cell surfaces. Integrins are cell surface proteins that play a critical role in cell adhesion, migration, and signaling. Integrin binding to the RGD sequence promotes cell attachment and interaction with the biomaterial.	price>
R-C-6115	S-lysoPC-d9 (18:0 LPC-d9)	LysoPC is generated through hydrolysis of the sn-2 acyl chain of PC by phospholipase A2.LysoPC is the substrate for Autotaxin/LysoPLD generating lysophosphatidic acid which has an important role in cell motility.This analog is deuterated on the choline headgroup.	price>
R-M2-10132	Cy5-TCGTCGTTTTGTCGTTTTGTCGT*T-Cholesteryl	Cy5-TCGTCGTTTTGTCGTTTTGTCGT*T-Cholesteryl is a CpG oligonucleotide with a CY5 fluorescent group labeled at the 5 end and cholesterol linked at the 3 end, mainly used in vaccine adjuvants and immunotherapy research.	price>
R-M1-8498	mPEG20K-BSA	mPEG20K-BSA refers to a conjugate of Bovine Serum Albumin (BSA) and mPEG20K, which stands for methoxy polyethylene glycol with a molecular weight of 20,000. BSA is a protein commonly derived from the blood of cows and is widely used in biochemical research, diagnostics, and various other applications. It has a range of uses in areas such as enzyme assays, cell culture, and protein standards.	price>

112411251126112711281129 11301131113211331134