D3 style ASO,Tagged Alexaflour 488 at 3

Catalog #	Pkg Size	Price(USD)	Quantity	Buy this product
R-M2-11037	100nmol	1309.00	- +	+ Add to cart

Product description

D3 style ASO, tagged Alexa Fluor 488 at 3(D3 style ASO, tagged Alexa Fluor 488 at position 3) is a functional probe designed using the D3 classic gapmer antisense oligonucleotide optimization paradigm. It accurately covalently couples Alexa Fluor 488 green fluorophore at its 3 end and is currently the mainstream standardized fluorescent labeling tool for cell tracking, subcellular localization, and efficacy correlation analysis in ASO drug development.

Appearance	N/A
Molecular Weight	N/A
Solubility	N/A
Molecular formula	N/A
Sequence	5GGTGGTGGTGGTTGTGGTGGTGGTGGTTTTTTTTTTGTAGCTCATAGCCG 3
Storage	-20℃, protected from light and moisture
Transportation	4-25℃ temperature for up to 1-3 weeks
Stability	6 months

Document